Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum M0795
Start position: 1577211
End position: 1577234
Length: 24

DNA sequence
>NC_019970, from 1577211 to 1577234 (24 bp); Thermoanaerobacterium thermosaccharolyticum M0795 TATTATTATTGTTACTATTGTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1576345-1577715	Sequence	Thethe_01616 - signal transduction histidine kinase (Protein is coded in complementary strand; from 1577715 to 1576345)