Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum M0795
Start position: 1466109
End position: 1466138
Length: 30

DNA sequence
>NC_019970, from 1466109 to 1466138 (30 bp); Thermoanaerobacterium thermosaccharolyticum M0795 AAAAAAGAAAAATAAAGACAAAAAACAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1464785-1466503	Sequence	Thethe_01501 - putative RNA-binding protein, snRNP like protein