Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum M0795
Start position: 1014092
End position: 1014115
Length: 24

DNA sequence
>NC_019970, from 1014092 to 1014115 (24 bp); Thermoanaerobacterium thermosaccharolyticum M0795 ATTTTTAATTTTATCTTTATTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1013595-1014308	Sequence	Thethe_01009 - 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase (Protein is coded in complementary strand; from 1014308 to 1013595)