Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 894023
End position: 894046
Length: 24

DNA sequence
>NC_019964, from 894023 to 894046 (24 bp); Halovivax ruber XH-70 CGCCGACGCCGGCGCCCACGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 893026-894543	Sequence	Halru_0851 - methyltransferase family protein (Protein is coded in complementary strand; from 894543 to 893026)