Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 885915
End position: 885938
Length: 24

DNA sequence
>NC_019964, from 885915 to 885938 (24 bp); Halovivax ruber XH-70 CCGTCGCCATCGGCGTCGACGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 884967-886751	Sequence	Halru_0845 - Glucose / Sorbosone dehydrogenase (Protein is coded in complementary strand; from 886751 to 884967)