Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 878704
End position: 878730
Length: 27

DNA sequence
>NC_019964, from 878704 to 878730 (27 bp); Halovivax ruber XH-70 TTCGATCTGTTCGATCTGTTCGATCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 878045-879688	Sequence	Halru_0840 - acyl-CoA synthetase/AMP-acid ligase (Protein is coded in complementary strand; from 879688 to 878045)