Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 862459
End position: 862482
Length: 24

DNA sequence
>NC_019964, from 862459 to 862482 (24 bp); Halovivax ruber XH-70 TCGTCGTCGGCGTCGTCCTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 861058-862488	Sequence	Halru_0822 - PBS lyase HEAT-like repeat protein (Protein is coded in complementary strand; from 862488 to 861058)