Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 838122
End position: 838146
Length: 25

DNA sequence
>NC_019964, from 838122 to 838146 (25 bp); Halovivax ruber XH-70 GGCCGGACCGGGCCCTGCCGGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 837937-839016	Sequence	Halru_0801 - NADH:ubiquinone oxidoreductase subunit 1 (chain H) (Protein is coded in complementary strand; from 839016 to 837937)