Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 788546
End position: 788569
Length: 24

DNA sequence
>NC_019964, from 788546 to 788569 (24 bp); Halovivax ruber XH-70 ACGCCGGCGCCGACGGCGACGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 787934-789310	Sequence	Halru_0752 - adenylosuccinate synthase (Protein is coded in complementary strand; from 789310 to 787934)