Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 675923
End position: 675946
Length: 24

DNA sequence
>NC_019964, from 675923 to 675946 (24 bp); Halovivax ruber XH-70 CGACGAGGACGACGACGGCGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 674671-676050	Sequence	Halru_0638 - hypothetical protein (Protein is coded in complementary strand; from 676050 to 674671)