Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 669268
End position: 669291
Length: 24

DNA sequence
>NC_019964, from 669268 to 669291 (24 bp); Halovivax ruber XH-70 TCGGCGTCGGCCTCGACGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 668986-669783	Sequence	Halru_0633 - putative hydrolase or acyltransferase of alpha/beta superfamily (Protein is coded in complementary strand; from 669783 to 668986)