Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 636570
End position: 636593
Length: 24

DNA sequence
>NC_019964, from 636570 to 636593 (24 bp); Halovivax ruber XH-70 GCCGCCACCGCCGTCGCCGCCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 636232-638079	Sequence	Halru_0605 - subtilisin-like serine protease (Protein is coded in complementary strand; from 638079 to 636232)