Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 609037
End position: 609072
Length: 36

DNA sequence
>NC_019964, from 609037 to 609072 (36 bp); Halovivax ruber XH-70 TCTCGCCGTCGCTTTCGGCGTCGCTCTCGTCGTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 608016-609311	Sequence	Halru_0572 - putative DHD superfamily phosphohydrolase (Protein is coded in complementary strand; from 609311 to 608016)