Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 3175612
End position: 3175647
Length: 36

DNA sequence
>NC_019964, from 3175612 to 3175647 (36 bp); Halovivax ruber XH-70 TCGACTGTCTTCTCGACCGTCTCCTCGACGGTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3175210-3175986	Sequence	Halru_3140 - hypothetical protein (Protein is coded in complementary strand; from 3175986 to 3175210)