Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 3066683
End position: 3066709
Length: 27

DNA sequence
>NC_019964, from 3066683 to 3066709 (27 bp); Halovivax ruber XH-70 CCTCGTCGGCCGCGTCGGCCGCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3064765-3067521	Sequence	Halru_3034 - subtilisin-like serine protease (Protein is coded in complementary strand; from 3067521 to 3064765)