Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 2923348
End position: 2923371
Length: 24

DNA sequence
>NC_019964, from 2923348 to 2923371 (24 bp); Halovivax ruber XH-70 GACGCCGACGACGACCCCGACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2922872-2924161	Sequence	Halru_2884 - arabinose efflux permease family protein (Protein is coded in complementary strand; from 2924161 to 2922872)