Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 2717563
End position: 2717589
Length: 27

DNA sequence
>NC_019964, from 2717563 to 2717589 (27 bp); Halovivax ruber XH-70 CGTCCTCGACGTACTCGACGTCCACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2716425-2718149	Sequence	Halru_2691 - phage tail sheath protein FI (Protein is coded in complementary strand; from 2718149 to 2716425)