Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 2457533
End position: 2457556
Length: 24

DNA sequence
>NC_019964, from 2457533 to 2457556 (24 bp); Halovivax ruber XH-70 ACTCGATCTCGAAGTCGAACTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2456539-2457795	Sequence	Halru_2434 - ABC-type branched-chain amino acid transport system, periplasmic component (Protein is coded in complementary strand; from 2457795 to 2456539)