Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 1920749
End position: 1920772
Length: 24

DNA sequence
>NC_019964, from 1920749 to 1920772 (24 bp); Halovivax ruber XH-70 CGTCGTCTTCGTCCTCGTCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1919518-1921122	Sequence	Halru_1879 - electron transfer flavoprotein, alpha subunit (Protein is coded in complementary strand; from 1921122 to 1919518)