Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 1858855
End position: 1858878
Length: 24

DNA sequence
>NC_019964, from 1858855 to 1858878 (24 bp); Halovivax ruber XH-70 GTCGTCTTCGTCCTCGTCCTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1858853-1860778	Sequence	Halru_1821 - chaperone protein DnaK (Protein is coded in complementary strand; from 1860778 to 1858853)