Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 1444958
End position: 1444981
Length: 24

DNA sequence
>NC_019964, from 1444958 to 1444981 (24 bp); Halovivax ruber XH-70 TCGTCGTCCTCGTCATCGTCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1444922-1445260	Sequence	Halru_1393 - 50S ribosomal protein L12P (Protein is coded in complementary strand; from 1445260 to 1444922)