Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 1350940
End position: 1350963
Length: 24

DNA sequence
>NC_019964, from 1350940 to 1350963 (24 bp); Halovivax ruber XH-70 TCGTCGCCGTCGTCTTCGTCGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1348345-1352016	Sequence	Halru_1298 - ATPase, type IV secretory pathway VirB11 component like protein (Protein is coded in complementary strand; from 1352016 to 1348345)