Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 1227259
End position: 1227282
Length: 24

DNA sequence
>NC_019964, from 1227259 to 1227282 (24 bp); Halovivax ruber XH-70 GAGCCCGAGCCAGAGTCCGAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1226228-1227652	Sequence	Halru_1184 - amino acid transporter (Protein is coded in complementary strand; from 1227652 to 1226228)