Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 1152417
End position: 1152443
Length: 27

DNA sequence
>NC_019964, from 1152417 to 1152443 (27 bp); Halovivax ruber XH-70 CGTCGATGGCGTCGATCGCGACGATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1152206-1153957	Sequence	Halru_1118 - pyruvate kinase (Protein is coded in complementary strand; from 1153957 to 1152206)