Sequence retrieval

Genome: Halovivax ruber XH-70
Start position: 1125436
End position: 1125459
Length: 24

DNA sequence
>NC_019964, from 1125436 to 1125459 (24 bp); Halovivax ruber XH-70 CGTCTTCGTCGTCCTCTTCGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1123689-1125572	Sequence	Halru_1093 - ABC-type dipeptide transport system, periplasmic component (Protein is coded in complementary strand; from 1125572 to 1123689)