Sequence retrieval

Genome: Vibrio parahaemolyticus BB22OP
Start position: 840781
End position: 840804
Length: 24

DNA sequence
>NC_019955, from 840781 to 840804 (24 bp); Vibrio parahaemolyticus BB22OP TTGGGATTGCGATTGTGATTGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 840358-841092	Sequence	VPBB_0770 - Permease of the major facilitator superfamily