Sequence retrieval

Genome: Vibrio parahaemolyticus BB22OP
Start position: 3143357
End position: 3143416
Length: 60

DNA sequence
>NC_019955, from 3143357 to 3143416 (60 bp); Vibrio parahaemolyticus BB22OP CTTCTGCTTCTGCTTCTGCTTCTGCTTCTGCTTCTGCTTCTGCTTCTGCTTCTGCTTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3142387-3143622	Sequence	VPBB_2794 - Signal recognition particle receptor protein FtsY (alpha subunit) (Protein is coded in complementary strand; from 3143622 to 3142387)