Sequence retrieval

Genome: Vibrio parahaemolyticus BB22OP
Start position: 3017156
End position: 3017182
Length: 27

DNA sequence
>NC_019955, from 3017156 to 3017182 (27 bp); Vibrio parahaemolyticus BB22OP CCACCCATACCGCCCATACCACCCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3017141-3018784	Sequence	VPBB_2701 - Heat shock protein 60 family chaperone GroEL (Protein is coded in complementary strand; from 3018784 to 3017141)