Sequence retrieval

Genome: Vibrio parahaemolyticus BB22OP
Start position: 2942687
End position: 2942711
Length: 25

DNA sequence
>NC_019955, from 2942687 to 2942711 (25 bp); Vibrio parahaemolyticus BB22OP CTGCGCTGCCATGCGGTGCGCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2942380-2942736	Sequence	VPBB_2631 - tRNA 5-methylaminomethyl-2-thiouridine synthase TusC (Protein is coded in complementary strand; from 2942736 to 2942380)