Sequence retrieval

Genome: Vibrio parahaemolyticus BB22OP
Start position: 2622073
End position: 2622096
Length: 24

DNA sequence
>NC_019955, from 2622073 to 2622096 (24 bp); Vibrio parahaemolyticus BB22OP AGCTGCCGCTGCAGGTGCTGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2621081-2622967	Sequence	VPBB_2340 - Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (Protein is coded in complementary strand; from 2622967 to 2621081)