Sequence retrieval

Genome: Vibrio parahaemolyticus BB22OP
Start position: 242420
End position: 242443
Length: 24

DNA sequence
>NC_019955, from 242420 to 242443 (24 bp); Vibrio parahaemolyticus BB22OP AGAAGTAGACGTAGAAGTAGACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 242403-242621	Sequence	VPBB_0226 - hypothetical protein (Protein is coded in complementary strand; from 242621 to 242403)