Sequence retrieval

Genome: Vibrio parahaemolyticus BB22OP
Start position: 465642
End position: 465676
Length: 35

DNA sequence
>NC_019955, from 465642 to 465676 (35 bp); Vibrio parahaemolyticus BB22OP GATGATGGTTGATGGTTGATGGTTGATGGTTGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 465637-466134	Sequence	VPBB_0446 - hypothetical protein (Protein is coded in complementary strand; from 466134 to 465637)