Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 977032
End position: 977058
Length: 27

DNA sequence
>NC_019952, from 977032 to 977058 (27 bp); Mycobacterium canettii CIPT 140070017 CGGCGCCGCCGGCACCGCCGGCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 976764-979409	Sequence	BN45_20116 PE_PGRS Conserved protein of unknown function, PE-PGRS family protein (Protein is coded in complementary strand; from 979409 to 976764)