Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 760004
End position: 760027
Length: 24

DNA sequence
>NC_019952, from 760004 to 760027 (24 bp); Mycobacterium canettii CIPT 140070017 CGTCGAGGTCGACGTCGACGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 759451-762744	Sequence	BN45_10723 recC Putative exonuclease V (gamma chain) RecC (exodeoxyribonuclease V gamma chain)(exodeoxyribonuclease V polypeptide) (Protein is coded in complementary strand; from 762744 to 759451)