Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 647125
End position: 647169
Length: 45

DNA sequence
>NC_019952, from 647125 to 647169 (45 bp); Mycobacterium canettii CIPT 140070017 CACCGACGACCGTCGCCCCGACGACCGTCGCCCCGACGACCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 645763-647400	Sequence	BN45_10605 - Conserved membrane protein of unknown function