Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 637043
End position: 637102
Length: 60

DNA sequence
>NC_019952, from 637043 to 637102 (60 bp); Mycobacterium canettii CIPT 140070017 CTAGCGAGGGTTCTAGCGAGGGTTCTAGCGAGGGTTCTAGCGAGGGTTCTAGCGAGGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 635827-637047	Sequence	BN45_10594 - hypothetical protein
ORF... 637092-637253	Sequence	BN45_10595 - hypothetical protein (Protein is coded in complementary strand; from 637253 to 637092)