Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 629440
End position: 629466
Length: 27

DNA sequence
>NC_019952, from 629440 to 629466 (27 bp); Mycobacterium canettii CIPT 140070017 CGGCGGCAACGGCGGCAACGGCGGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 628989-629603	Sequence	BN45_10587 - Conserved protein of unknown function, PE-PGRS family PE_PGRS33 (fragment)