Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 542887
End position: 542910
Length: 24

DNA sequence
>NC_019952, from 542887 to 542910 (24 bp); Mycobacterium canettii CIPT 140070017 GCGGCGGCGACGGCGACGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 542254-543024	Sequence	BN45_10490 - Conserved membrane protein of unknown function (Protein is coded in complementary strand; from 543024 to 542254)