Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 4278215
End position: 4278241
Length: 27

DNA sequence
>NC_019952, from 4278215 to 4278241 (27 bp); Mycobacterium canettii CIPT 140070017 ACCCGGCATACCCGGCATACCCGGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4278183-4278584	Sequence	BN45_110075 - hypothetical protein (Protein is coded in complementary strand; from 4278584 to 4278183)