Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 4034019
End position: 4034045
Length: 27

DNA sequence
>NC_019952, from 4034019 to 4034045 (27 bp); Mycobacterium canettii CIPT 140070017 GGCAACGGCGGCAACGGCGGCAACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4031254-4035507	Sequence	BN45_70172 PE_PGRS Conserved protein of unknown function, PE-PGRS family protein (PE-PGRS 53-fragment)