Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 3863107
End position: 3863133
Length: 27

DNA sequence
>NC_019952, from 3863107 to 3863133 (27 bp); Mycobacterium canettii CIPT 140070017 CCGCCGGTGCCGCCGGTGCCGCCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3862342-3863328	Sequence	BN45_60395 - Conserved protein of unknown function, PE-PGRS family protein (fragment) (Protein is coded in complementary strand; from 3863328 to 3862342)