Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 364997
End position: 365041
Length: 45

DNA sequence
>NC_019952, from 364997 to 365041 (45 bp); Mycobacterium canettii CIPT 140070017 ACACCCGTGTTGTAGTCACCCGCGTTGAAGTAGCCCGTGTTGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 363179-372724	Sequence	BN45_10335 - Conserved protein of unknown function, PPE family (Protein is coded in complementary strand; from 372724 to 363179)