Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 338869
End position: 338904
Length: 36

DNA sequence
>NC_019952, from 338869 to 338904 (36 bp); Mycobacterium canettii CIPT 140070017 GACCACGATCATGACCACGATCATGACCACGATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 338321-339955	Sequence	BN45_10312 ppe Conserved protein of unknown function, uncharacterized PPE family protein PPE3 (fragment)