Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 320232
End position: 320267
Length: 36

DNA sequence
>NC_019952, from 320232 to 320267 (36 bp); Mycobacterium canettii CIPT 140070017 CGGCCTCGAAACCGGCCTCGAAACCGGCCTCGAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 318683-322324	Sequence	BN45_10292 oplA Putative 5-oxoprolinase OplA (5-oxo-l-prolinase) (pyroglutamase) (5-opase) (Protein is coded in complementary strand; from 322324 to 318683)