Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 3038515
End position: 3038559
Length: 45

DNA sequence
>NC_019952, from 3038515 to 3038559 (45 bp); Mycobacterium canettii CIPT 140070017 TCGGCAACATCGGCAACGACAACATTGGCAACGCCAACATCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3037933-3039675	Sequence	BN45_51001 PPE Conserved protein of unknown function, PPE family