Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 2909898
End position: 2909924
Length: 27

DNA sequence
>NC_019952, from 2909898 to 2909924 (27 bp); Mycobacterium canettii CIPT 140070017 CACCGTTGCCACCGTTGCCACCGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2907779-2912761	Sequence	BN45_50872 PE_PGRS Conserved protein of unknown function, PE-PGRS family protein PE_PGRS54 (Protein is coded in complementary strand; from 2912761 to 2907779)