Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 2627467
End position: 2627520
Length: 54

DNA sequence
>NC_019952, from 2627467 to 2627520 (54 bp); Mycobacterium canettii CIPT 140070017 CGTGGTCGCCGGCGGCTGCGTGGTCGCCGGCGGCTGCGTGGTCGCCGGCGGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2627351-2629147	Sequence	BN45_50594 - Conserved protein of unknown function, proline rich protein (Protein is coded in complementary strand; from 2629147 to 2627351)