Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 2500647
End position: 2500676
Length: 30

DNA sequence
>NC_019952, from 2500647 to 2500676 (30 bp); Mycobacterium canettii CIPT 140070017 TGGCTAGTCTCGGCTAGTCTCGGCTAGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2500671-2501453	Sequence	BN45_50470 wag Conserved protein of unknown function, Wag31 (Protein is coded in complementary strand; from 2501453 to 2500671)