Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 2246568
End position: 2246612
Length: 45

DNA sequence
>NC_019952, from 2246568 to 2246612 (45 bp); Mycobacterium canettii CIPT 140070017 CGATGCCAGTGTTGGCGATGCCGGCGTTGAAGAAGCCCGTGTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2241074-2247592	Sequence	BN45_50187 PPE Conserved protein of unknown function, PPE family protein (Protein is coded in complementary strand; from 2247592 to 2241074)