Sequence retrieval

Genome: Mycobacterium canettii CIPT 140070017
Start position: 2223429
End position: 2223476
Length: 48

DNA sequence
>NC_019952, from 2223429 to 2223476 (48 bp); Mycobacterium canettii CIPT 140070017 CGGCCCATCGAGACTCCGGCCCATCGAGACTCCGGCCCATCGAGACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2223369-2223914	Sequence	BN45_50170 - Conserved exported protein of unknown function, lipoprotein LppD (part1) (Protein is coded in complementary strand; from 2223914 to 2223369)